La génomique - Un train qui arrive à grande allure

Il est quasi impossible que les producteurs de bœufs n'aient pas encore entendu parler, soit en lisant des articles ou des annonces publicitaires, de l'utilisation des technologies portant sur l'ADN dans l'industrie du bovins de boucherie. La génomique est un terme à la mode faisant simplement référence à un domaine général de la génétique où l'on utilise les technologies de l'ADN. Jusqu'à ce jour, la mise en application des marqueurs d'ADN est assez rare. La majorité des producteurs n'utilisent pas encore cette technologie qui est facile d'accès avec trois grandes compagnies concurrentielles en Amérique du Nord. Ce que les producteurs avant-gardistes d'aujourd'hui ne réalisent pas est que les outils qui seront disponibles dans le futur comme moyen de sélection et de gestion seront très différents de ceux qui existent actuellement. Cet article vise à fournir des informations de base sur le sujet et à donner au secteur bovin un aperçu de l'impact auquel il devra s'attendre en ce qui concerne le train de la génomique qui arrive à grande allure.

Génétique 101

L'ADN qui est présent dans chacune des cellules d'un bovin de boucherie renferme le code qui va déterminer la base génétique du devenir de cet animal; de la couleur de son poil à son potentiel de croissance ou à la tendreté de sa viande. Il est évident que l'environnement (rations alimentaires, etc.) a un impact d'importance sur le développement de l'animal. En fait, en ce qui concerne la majorité des caractères qui nous importent, l'environnement est responsable à 60-80 pourcent des différences que nous pouvons voir entre les animaux. L'autre tranche de 20-40 pourcent, qui est attribuable à la génétique, a également une grande valeur. Nous pouvons exploiter ce pourcentage par une sélection génétique efficace comme c'est le cas avec les tendances génétiques qui favorisent les caractères comme le taux de croissance chez le bœuf de boucherie, la production de lait chez la vache laitière ou le pourcentage de viande maigre chez le porc à l'engrais.

La génomique nous permet de lire directement l'ADN d'un animal et de déterminer son potentiel pour un caractère donné, comme par exemple son rendement en viande maigre. Il s'agit là du point final visé, et le parcours pour y arriver est long. La bonne nouvelle est que cette technologie progresse à un rythme effarent. La grande partie des améliorations réalisées dans ce domaine cadre dans le Projet de séquençage bovin (Bovine Sequencing Project), lequel a permis de décrypter le génome du bovin. Le code d'ADN d'un animal est composé de quatre éléments de base (appelés nucléotides) que nous allons représenter par leur première lettre, soit G, A, C et T. La séquence d'un animal est simplement l'agencement unique de ces quatre lettres, comme par exemple :

AAGCTCGTGGCAATGGTCCATAGCCC…

Le code d'un seul animal comprend trois milliards de lettres. Si vous aviez à taper le code d'un animal sur une machine à écrire avec une police de 10 caractères par pouce, vous obtiendriez un ruban avec les lettres G, C, A et T qui traverserait le Canada d'un océan à l'autre. Si vous aviez les séquençages de deux vaches et que vous les disposiez en parallèle, vous trouveriez que leurs codes seraient identiques sur une grande proportion des rubans. La raison qui explique ces similitudes est que les deux sujets sont des vaches, et même si elles sont de races différentes, elles possèdent beaucoup plus de codes identiques que de codes différents. En d'autres mots, ce sont des vaches, ce sont des mammifères, elles ont quatre pattes, deux yeux, des poils et ainsi de suite; ce qui explique qu'elles possèdent beaucoup de codes identiques. Toutefois, à mesure que vous parcourez le chemin de Halifax à Victoria et que vous lisez les rubans des 2 vaches, vous allez remarquer qu'il y a des différences à certains endroits. Par exemple, vous allez noter qu'à un endroit sur le ruban d'une des vaches il y a un G, alors qu'au même endroit sur le ruban de l'autre vache, il y a un C. Cette différence est appelée Polymorphisme d'un nucléotide simple ou PNS. Il y a à ce jour plus de deux millions de ces PNS d'identifiés chez le bovin (d'autres sont à découvrir). Cela signifie qu'à mesure que vous lisez le code en parcourant le pays, vous allez rencontrer un PNS à toutes les 1500 lettres ou à tous les 12 pieds. S'il vous est possible d'imaginer le nombre d'arrêts à tous les 15 pieds de Halifax à Calgary, vous pouvez ainsi imaginer qu'il y a beaucoup de PNS de découverts!

Ces PNS sont les différences génétiques fondamentales que nous désirons exploiter au moment de sélectionner un animal. Cela peut sembler de la science fiction, mais il n'en est rien. En fait, les éleveurs de bovins font de la sélection depuis le début de la domestication. Pensez au ruban qui traverse le Canada avec des A, G, C et T. Supposons maintenant qu'une race bovine en particulier est sélectionnée en vue d'accroître son taux de croissance et qu'il y a un PNS sur le ruban juste à l'est de Bowmanville dont le code est G/C. Supposons aussi que les animaux qui ont le code G à cet endroit se développent plus rapidement que ceux qui ont le code C. Comme la pression sélective va améliorer le taux de croissance avec le temps, la présence des G va augmenter puisque les taureaux avec le génotype GG (chez un animal, les "rubans" viennent en paires, car chaque cellule est constituée d'une paire de segments d'ADN) auront tendance à croître plus rapidement que les taureaux avec le génotype CC. Plus les taureaux GG sont utilisés, plus la présence des codes G à cet endroit devient courante jusqu'à ce que les codes C finissent par disparaître de cet endroit. Cette race est alors fixe à cet endroit avec des G. On serait porté à croire que, suite à une certaine période de sélection, la race fixerait tous les bons PNS et que la sélection cesserait. Il a été démontré que cette hypothèse est fausse, en raison des mutations qui interviennent dans le génome. Ces mutations créent de nouveaux PNS et certains d'entre eux seront inévitablement liés au taux de croissance. Le processus de sélection va donc se poursuivre. Il a été démontré avec des mouches à fruits expérimentales (qui se reproduisent très rapidement), qu'après des centaines de générations de sélection, la réponse à la sélection ne diminue pas. C'est une bonne nouvelle pour les sélectionneurs d'animaux d'élevage.

"Le gène" n'existe pas

Dans les débuts de la commercialisation des analyses génétiques, les sélectionneurs se sont dit "Ils ont trouvé le gène du persillage, nous n'avons plus besoin d'utiliser les mesures aux ultrasons." Cet énoncé est faux pour deux raisons. Premièrement, le "gène du persillage" n'existe pas. Le potentiel génétique d'un animal pour le persillage est influencé par plusieurs gènes. En ce qui concerne la majorité de nos caractères, il a été estimé que près de 100 PNS sont requis pour expliquer presque toutes les différences génétiques d'un caractère pris individuellement. Deuxièmement, la génomique est en train de devenir un outil incroyable qui va révolutionner l'industrie de l'amélioration génétique. Nous sommes toutefois loin d'abandonner les programmes d'enregistrement traditionnels dans le secteur du bovin de boucherie. Les techniques génomiques vont plutôt être intégrées aux systèmes traditionnels. Dans le futur, les données EPD pour un animal sera une combinaison de son ADN, de son pedigree et de ses données de rendement, afin d'avoir une évaluation et une information plus précise sur son potentiel génétique pour un caractère donné, et ainsi pouvoir augmenter le taux de l'amélioration génétique.

Intégrer les PNS comme outil d'amélioration

Tel que mentionné plus haut, plusieurs PNS ont été identifiés chez le bovin. Cette connaissance en soi n'est d'aucune utilité aux sélectionneurs de bovins. Ce qu'il faut établir c'est le lien entre ces PNS et les caractères que l'on veut sélectionner. C'est exactement à ce niveau que l'Université de Guelph entre en cause. L'Université de Guelph, par le biais du programme de génomique bovine de l'Université de l'Alberta, effectue le séquençage de 1250 bovins pour un nombre de 50 000 (50K) PNS chacun. On mesure chez ces animaux un certain nombre de caractères importants de la naissance jusqu'à la carcasse, comme la conversion alimentaire et la tendreté de la viande. La recherche va pouvoir déterminer quels sont les PNS liés à un caractère donné, comme par exemple à la conversion alimentaire. Par la suite, ces PNS pourront être appliqués à un panel d'essai d'ADN commercial sur le terrain dans le but d'améliorer la sélection de ces caractères.

C'est une technologie de pointe. Cette initiative canadienne avec la participation du Département de l'agriculture des États-Unis et du Beef CRC de l'Australie effectue la compilation d'ensembles de données visant à offrir les meilleurs outils possibles aux sélectionneurs des trois pays, car il a été établi qu'il y aurait plus de puissance dans une compilation de données. L'inclusion de ces activités internationales démontre l'envergure des ressources disponibles en Ontario.

Est-ce le point d'arrivée ou de départ?

Nous avons maintenant une bonne idée de la recherche actuelle et de ce qui s'en vient. Il existe présentement des outils génomiques dont l'utilité a été validée pour les sélectionneurs. De plus, la capacité des analyses disponibles sur le marché augmente continuellement à mesure que d'autres PNS associés aux caractères d'importance sont découverts. Présentement, la recherche à l'Université de Guelph est impliquée dans la validation des nouveaux panels de PNS, en raison de notre ressource de données unique. Les producteurs pourraient s'attendre à des panels améliorés très prochainement, en avance des résultats des projets de séquençage de 50K ci-haut mentionnés.

Il est toujours dangereux de spéculer. N'empêche, qu'en pensant au futur, le producteur se demande à quoi il peut encore s'attendre? À quel moment est-ce que des panels de PNS plus gros seront disponibles et quelle sera leur taille? En se basant sur le développement de la technologie, il semble que les panels de PNS commerciaux disponibles au cours des quelques dernières années nous ont apportés deux PNS. Donc, ce nombre pourrait passer à 10-20 PNS au cours des deux prochaines années, et il pourrait doubler d'ici l'an 2012 pour des panels commerciaux de 40 PNS. Il s'agit là d'une technologie en pleine évolution!

Articles futurs

Maintenant que nous avons décrit les bases fondamentales de la génomique, de la génétique et de l'état actuel des technologies, d'autres articles seront présentés dans le Bœuf virtuel du MAAARO pour expliquer davantage le développement de la mise en pratique et de la validation des nouveaux outils d'analyses d'ADN visant à sélectionner les caractères d'importance comme la tendreté de la viande bovine et la conversion alimentaire.

Remerciements

La recherche en génomique de l'Université de Guelph serait impossible sans l'aide financière de nos partenaires, le Ministère de l'Agriculture, de l'Alimentation et des Affaires rurales de l'Ontario, lequel soutient les stations de recherche (y compris le personnel et le bétail d'élevage) et les projets de recherche. Nous tenons également à remercier le Ontario Cattlemen's Association et le Agriculture Adaptation Council pour leur aide financière.


Pour plus de renseignements :
Sans frais : 1 877 424-1300
Local : 519 826-4047
Courriel : ag.info.omafra@ontario.ca